Skip to main content

De novo transcriptome assembly of the oak processionary moth Thaumetopoea processionea

Abstract

Objectives

The oak processionary moth (OPM) (Thaumetopoea processionea) is a species of moth (order: Lepidoptera) native to parts of central Europe. However, in recent years, it has become an invasive species in various countries, particularly in the United Kingdom and the Netherlands. The larvae of the OPM are covered with urticating barbed hairs (setae) causing irritating and allergic reactions at the three last larval stages (L3-L5). The aim of our study was to generate a de novo transcriptomic assembly for OPM larvae by including one non-allergenic stage (L2) and two allergenic stages (L4 and L5). A transcriptomic assembly will help identify potential allergenic peptides produced by OPM larvae, providing valuable information for developing novel therapeutic strategies and allergic immunodiagnostic assays.

Data

Transcriptomes of three larval stages of the OPM were de novo assembled and annotated using Trinity and Trinotate, respectively. A total of 145,251 transcripts from 99,868 genes were identified. Bench-marking universal single-copy orthologues analysis indicated high completeness of the assembly. About 19,600 genes are differentially expressed between the non-allergenic and allergenic larval stages. The data provided here contribute to the characterization of OPM, which is both an invasive species and a health hazard.

Peer Review reports

Objectives

The impact of the OPM on human health is a significant concern [1]. Direct contact with the caterpillars or their setae containing potential allergenic peptides that can cause skin irritation, redness, itching, and the formation of painful rashes and blisters. In addition to dermatitis, the inhalation of the caterpillar hairs can lead to respiratory problems [2, 3]. The microscopic hairs can irritate the airways, causing symptoms such as coughing, wheezing, sore throat, and difficulty breathing [4]. In some cases, severe allergic reactions may occur, leading to asthma attacks or anaphylaxis, a life-threatening condition. To identify OPM allergens, we generated transcriptomic data for OPM larvae at the non-allergenic stage (L2) and at two allergenic stages (L4 and L5). The de novo transcriptomic assembly across all three stages defined the expressed genes and the predicted encoded peptides. Differential gene expression between the stages can highlight genes potentially involved in the allergenic properties of stages L4 and L5. These data will help identifying potential allergenic peptides produced by OPM larvae that can prospectively fill the diagnostic gap in the development of allergic immunization assays and allergy immunotherapy options.

Data description

RNA isolation and library preparation

Larvae of Thaumetopoea processionea were all collected from a single nest in an English oak tree (Quercus robur) in Briesener Zootzen (Germany, 52°45’18.6"N 12°40’29.3"E), in May 14, 2022 (L2 and L4 stages) and June 15, 2022 (L5 stage). The larvae were then brought to the laboratory, snap frozen in liquid nitrogen, and stored at -80 °C. Larvae were homogenized with mortar and pestle in liquid nitrogen and 20 mg of tissue was used for total RNA extraction with the Quick-RNA™ Tissue/Insect Microprep kit (Zymo, R2030). Eleven RNA-seq libraries (4 x L2 larvae, 4 x L4 larvae, 3 x L5 larvae) were prepared with NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB, E7760L). Paired-end sequencing (100 + 100 bp) was performed on the 11 pooled libraries on the MGISEQ-2000 (BGI) to obtain about 30–55 million reads per library.

Data filtering, transcriptome assembly and quality

We used the de novo transcriptome assembly pipeline recommended by the Harvard Faculty of Arts and Sciences Informatics Group (https://github.com/harvardinformatics/TranscriptomeAssemblyTools) which considers common issues [5]. The raw reads were first cleaned from rare kmers and sequencing errors using Rcorrector [6]. The read adaptors were then trimmed and bad quality reads were removed using cutadapt [7] (cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --quality-base 33 --max-n 0 -o output.R1.fq -p output.R2.fq input.R1.fq input.R2.fq). Ribosomal RNA sequences were removed using bowtie2 [8] against the Lepidoptera SSU and LSU rRNA sequences downloaded from the SILVA database (https://www.arb-silva.de) (bowtie2 --nofw --quiet --very-sensitive-local --phred33 -x index_bowtie − 1 input.R1.fq -2 input.R2.fq --un-conc-gz output.rRNA_removed.fq.gz > /dev/null). Over-represented sequences were removed using the python script RemoveFastqcOverrepSequenceReads.py (https://github.com/harvardinformatics/TranscriptomeAssemblyTools). Empty reads produced by cutadapt (header present but read sequence removed) were removed using a perl command (perl -i -p -e ‘s/^$/N/g;’ input.fq). The de novo assembly of the OPM transcriptome was performed using Trinity (v2.15.1) [9] using the pooled fastq files to build all possible transcripts across all three stages and biological replicates (Trinity --seqType fq --CPU 8 --max_memory 100G --left pooled.R1.fa --right pooled.R2.fa --SS_lib_type RF --output trinity_output). The assembly fasta file was uploaded on NCBI as transcriptomic shotgun assembly for verification, and transcripts identified as duplicates or matching other kingdoms were removed and resubmitted. Raw fastq files and transcriptome assembly are available in NCBI (Data file 1). The description statistics of the assembly generated with the Trinity perl script TrinityStats.pl is available in Data file 2.

Long open reading frames and derived peptide sequences were obtained using the Perl scripts TransDecoder.LongOrfs and TransDecoder.Predict, respectively (Haas, BJ. https://github.com/TransDecoder (v5.7.0)).

The completeness of the transcriptome assembly was determined with Benchmarking Universal Single-Copy Orthologs (BUSCO) software (v5.4.3) [10]. Longest isoforms of each gene (99,868 genes total) were retrieved using the get_longest_isoform_seq_per_trinity_gene.pl utility script from Trinity. These isoforms were compared to the 5,286 marker genes from the Lepidoptera lineage and the completeness found was 89.3%, including 84.9% and 4.4% of single-copy and duplicated genes, respectively (BUSCO analysis summary in Data file 3).

Annotation

Functional annotation of the transcriptome assembly generated by Trinity was performed with Trinotate (v3.2.2) [11] and provided in Data file 4.

Differential expression analysis

To identify differentially expressed between stages, a salmon (v0.10.2) [12] index was first build on the Trinity output fasta file (salmon index -Trinity.fasta -i Trinity.fasta.salmon.idx), the utility Trinity perl script was then used to perform alignment and abundance estimation on single samples (align_and_estimate_abundance.pl --transcripts Trinity.fasta --gene_trans_map Trinity.fasta.gene_trans_map --samples_file samples.txt --est_methold salmon --SS_lib_type RF). The output salmon quant.sf files from salmon were then imported in R using the tximport and DESeq2 (v1.28.1) packages [13, 14]. Differential expressed genes between stages and between the allergenic and non-allergenic stages were identified. Log fold change shrinkage was performed using the apelgm R package [15]. The lists of differentially expressed genes with an adjusted p-value below 5% for each comparison were summarized in an Excel spreadsheet (Data File 5).

Table 1 Overview of data files

Limitations

The de novo transcriptomic analysis of the OPM provided here considered only larval stages of the insect. Thus, the transcripts defined here represent only a fraction of the transcriptome. For instance, genes expressed specifically in the imago cannot be detected with our approach. A more comprehensive picture of the OPM transcriptome would require integrating samples from more developmental stages, e.g. egg, pupa, and imago life stages in a de novo transcriptome assembly.

Data availability

The raw RNA-seq and the transcriptome assembly are available on the NCBI accession number PRJNA1072613 [16]. See Table 1 and references [17–20] for Figshare results. Detailed bioinformatics scripts are available as a PDF document in Data File 6 [21] and on GitHub (https://github.com/johanzi/OPM_transcriptome_assembly).

Abbreviations

BUSCO:

Bench-marking universal single-copy orthologs

OPM:

Oak processionary moth

TSA:

Transcriptome shotgun assembly

SRA:

Short read archive

References

  1. Rahlenbeck S, Utikal J. The oak processionary moth: a new health hazard? Br J Gen Pract. 2015;65:435–6.

    Article  PubMed  PubMed Central  Google Scholar 

  2. Gottschling S, Meyer S. An epidemic airborne disease caused by the oak processionary caterpillar. Pediatr Dermatol. 2006;23:64–6.

    Article  PubMed  Google Scholar 

  3. Forkel S, Mörlein J, Sulk M, Beutner C, Rohe W, Schön M. Work-related hazards due to oak processionary moths: a pilot survey on medical symptoms. J Eur Acad Dermatol Venereol. 2021;35:e779–82.

    Article  CAS  PubMed  Google Scholar 

  4. Battisti A, Holm G, Fagrell B, Larsson S. Urticating Hairs in Arthropods: Their Nature and Medical Significance. Annu Rev Entomol. 2011;56 Volume 56, 2011:203–20.

  5. Freedman AH, Clamp M, Sackton TB. Error, noise and bias in de novo transcriptome assemblies. Mol Ecol Resour. 2021;21:18–29.

    Article  CAS  PubMed  Google Scholar 

  6. Song L, Florea L. Rcorrector: efficient and accurate error correction for Illumina RNA-seq reads. GigaScience. 2015;4:48.

    Article  PubMed  PubMed Central  Google Scholar 

  7. Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 2011;17:10–2.

    Article  Google Scholar 

  8. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9:357–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol. 2011;29:644–52.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Manni M, Berkeley MR, Seppey M, Simão FA, Zdobnov EM. BUSCO Update: Novel and Streamlined Workflows along with broader and deeper phylogenetic Coverage for Scoring of Eukaryotic, Prokaryotic, and viral genomes. Mol Biol Evol. 2021;38:4647–54.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Bryant DM, Johnson K, DiTommaso T, Tickle T, Couger MB, Payzin-Dogru D, et al. A tissue-mapped Axolotl De Novo Transcriptome enables identification of limb regeneration factors. Cell Rep. 2017;18:762–76.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Patro R, Duggal G, Love MI, Irizarry RA, Kingsford C. Salmon provides fast and bias-aware quantification of transcript expression. Nat Methods. 2017;14:417–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Love MI, Huber W, Anders S. Moderated estimation of Fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550.

    Article  PubMed  PubMed Central  Google Scholar 

  14. Soneson C, Love MI, Robinson MD. Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences. 2016.

  15. Zhu A, Ibrahim JG, Love MI. Heavy-tailed prior distributions for sequence count data: removing the noise and preserving large differences. Bioinformatics. 2019;35:2084–92.

    Article  CAS  PubMed  Google Scholar 

  16. Zicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. De novo transcriptome assembly of the oak processionary moth Thaumetopoea processionea. NCBI BioProject. https://identifiers.org/bioproject:PRJNA1072613. 2024.

  17. Zicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. De novo transcriptome assembly of the oak processionary moth Thaumetopoea processionea. GenBank entry. https://www.ncbi.nlm.nih.gov/nuccore/GKRZ00000000.1. 2024.

  18. Zicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. Summary statistics of the de novo transcriptome assembly of oak processionary moth (larval stages L2, L4, L5). Figshare. 2024. https://doiorg.publicaciones.saludcastillayleon.es/10.6084/m9.Figshare.25333600.v1.

    Article  Google Scholar 

  19. Zicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. Benchmarking Universal single-Copy orthologues (BUSCO) analysis on the de novo transcriptome assembly of the oak processionary moth (larval stages L2, L4, L5). Figshare. 2024. https://doiorg.publicaciones.saludcastillayleon.es/10.6084/m9.Figshare.25333603.v1.

    Article  Google Scholar 

  20. Zicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. Trinotate annotation of the de novo transcriptome assembly of the oak processionary moth (larval stages L2, L4, and L5). Figshare. 2024. https://doiorg.publicaciones.saludcastillayleon.es/10.6084/m9.Figshare.25333753.v1.

    Article  Google Scholar 

  21. Zicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. Differential gene expression analyses between larval stages of the oak processionary moth (Thaumetopoea processionea). Figshare. 2024. https://doiorg.publicaciones.saludcastillayleon.es/10.6084/m9.Figshare.25333777.v1.

    Article  Google Scholar 

  22. Zicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. Bioinformatic script for the de novo transcriptome assembly analysis of the oak processionary moth (Thaumetopoea processionea). Figshare. 2024. https://doiorg.publicaciones.saludcastillayleon.es/10.6084/m9.Figshare.25334269.v1.

    Article  Google Scholar 

Download references

Funding

This work was supported by a grant from the Federal Ministry of Food and Agriculture (Germany) to TB (FNR #22220NR145X). Open Access funding enabled and organized by Projekt DEAL. We acknowledge support by the Open Access Publication Funds of Göttingen University.

Open Access funding enabled and organized by Projekt DEAL.

Author information

Authors and Affiliations

Authors

Contributions

SS and TB designed the experiment, AM collected the larvae, PD and KKH identified the larvae and conditioned the samples, KZK extracted RNA from the samples prepared the RNA-seq libraries, JZ performed the analyses and wrote the manuscript. All authors reviewed the manuscript.

Corresponding author

Correspondence to Stefan Scholten.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Zicola, J., Dasari, P., Hahn, K.K. et al. De novo transcriptome assembly of the oak processionary moth Thaumetopoea processionea. BMC Genom Data 25, 55 (2024). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12863-024-01237-7

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12863-024-01237-7

Keywords